4 μM of each primer GBV-F1 (5′ CGGCCAAAAGGTGGTGGATG 3′) and GBV-R1 (5′ CACTGGTCCTTGTCAACTCG 3′), 5 μl of sample, 4
units AMV RT (Promega), 16 units of RNasin (Promega) and 1 unit of AmpliTaq DNA polymerase in a 50μl reaction. Cycling conditions were: 42°C for 60 min, and 35 cycles of 95°C for 1.5 min, 55°C for 2 min, 72°C for 3 min. The expected product size was 299 bp. Selleckchem LY3023414 Five μl of the first round reaction was used for a second round PCR reaction, which consisted of 1× AmpliTaq buffer, 2 mM MgCl2, 200 μM dNTP mix, 0.4 μM of each primer GBV-F2 (5′ GGTGATGACAGGGTTGGTAG 3′) and GBV-R2 (5′ GCCTATTGGTCAAGAGAGACAT 3′), 1.25 U AmpliTaq DNA polymerase in a 50μl reaction. Reaction conditions were 94°C for 10 min, 35 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, and 72°C for 10 minutes. The expected PCR product size was 251 bp. The diversity of GBV-C reads were compared https://www.selleckchem.com/products/bmn-673.html against a database of complete GBV-C genome sequences from Genbank (23 sequences) using BLAST. A sequence was classified as similar to a
certain isolate if the BLAST hit e-value was < 10-20 and if the top hit was at least 100 times more significant than the second hit. Financial Disclosures The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. In the interests of full disclosure, Dr. Sullivan reports receiving unrestricted research funding from Eli Lilly for genetic research in schizophrenia. LCZ696 ic50 The other authors report no conflicts. Acknowledgements This project was funded by R01 AI056014 to PFS from the National Institute of Allergy and Infectious Diseases of the
US National Institutes of Health. Additional funding was from the Swedish Research Council and the PhD Programme in Medical Bioinformatics with support from the Knowledge Foundation. Electronic supplementary material Additional file 1: Supplemental figures. contains the two supplemental figures referenced in the text. (DOC 1 MB) References 1. Fukuda K, Strauss SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A: The chronic fatigue syndrome: PDGFR inhibitor a comprehensive approach to its definition and study. Ann Int Med 1994, 121: 953–959.PubMed 2. Reeves WC, Lloyd A, Vernon SD, Klimas N, Jason LA, Bleijenberg G, Evengard B, White PD, Nisenbaum R, Unger ER: Identification of ambiguities in the 1994 chronic fatigue syndrome research case definition and recommendations for resolution. BMC Health Serv Res 2003, 3: 25.PubMedCrossRef 3. Komaroff AL, Buchwald DS: Chronic fatigue syndrome: an update. Annual Review of Medicine 1998, 49: 1–13.PubMedCrossRef 4. Mihrshahi R, Beirman R: Aetiology and pathogenesis of chronic fatigue syndrome: a review. N Z Med J 2005, 118: U1780.PubMed 5. Devanur LD, Kerr JR: Chronic fatigue syndrome. J Clin Virol 2006, 37: 139–150.PubMedCrossRef 6.