Briefly, all strains were grown overnight

in LB medium, sub-cultured into NM2 medium (1 mM Mg2+) (1/100 dilution) and grown to mid-log phase. All cultures were normalized to a common OD600 value and 10 μl of mid-log culture (~6 × 105 cfu) was inoculated into 90 μl of NM2 media containing repressing levels Mg2+ (1 mM), with or without 5 mg/ml DNA-sodium salt. Microtitre plates containing the antibiotic dilution series and bacteria were incubated for 18 hours at 37°C. The MIC was determined as the concentration of antibiotic that reduced growth to an OD600 value less than 0.1. The median MIC values from three experiments are shown. Flow chamber biofilm cultivation and imaging Biofilms were grown in flow chambers with channel dimensions of selleck products 1 × 4 × 40 mm as previously described but with minor modifications [30]. Autoclaved silicone tubing (VWR, .062 ID x .125 OD x .032 wall) was assembled

and sterilized by pumping 0.5% hypochlorite solution through the flow chamber for 2 hours. For rinsing, sterile water was pumped though for 30 minutes followed by LB media for 30 minutes. Flow chambers were inoculated by injecting with a syringe, 400 μl of mid-log culture diluted to an OD600 of 0.02. After inoculation, PD0332991 concentration chambers were left without flow for two hours to allow the bacteria to adhere, after which media was pumped though the system at a constant rate of 0.75 rpm (3.6 ml/hour). Biofilms were cultivated for 48 hours at 37°C in

LB medium and stained with the membrane staining dye FM 4–64 (Invitrogen), the extracellular DNA stains TOTO-1 or Sytox Red (Invitrogen), or an EPS stain fluorescent Methocarbamol brightener 28 (Sigma). Biofilms were imaged using a Leica DMI 4000 B widefield fluorescence microscope equipped with filter sets for blue (Ex 390/40, Em 455/50), green (Ex 490/20, Em 525/36) and red (Ex 555/25, Em 605/52) fluorescence using the Quorum Angstrom Optigrid (MetaMorph) acquisition software. Images were obtained with a 63 × 1.4 objective. Deconvolution was performed with Huygens Essential (Scientific Volume Imaging B.V.) and 3D reconstructions were generated using the Imaris software package (Bitplane AG). Monitoring pmrH-gfp expression in flow chamber biofilms The promoter of pmrH was amplified from genomic DNA of S. typhimurium 14028 using the primer pair pmrF-1 (AGTCCTCGAGACTACCGGATGCTGCTTC) and pmrF-2 (AGTCGGATCCATTGCCAGTTAGCCGACA), digested with BamHI-XhoI and cloned into Liproxstatin1 BamHI-XhoI-digested pCS21 upstream of a gfpmut3 reporter [31]. The pmrH-gfp vector was moved into S. Typhimurium 14028 by electroporation. Flow chamber biofilms were cultivated in NM2 containing 0.1 mM Mg2+ for 28 hours and then 10 mM Mg2+ was introduced into the growth media for an additional 16 hours of biofilm cultivation prior to imaging. Acknowledgements This work is dedicated to the memory of our colleague Dmitry Apel.