After 6 months she was referred to the maternity hospital learn more because of treatment-resistant anemia (Hb 72 g/L). Tests for hemolysis were positive with Hb 68 g/L at its lowest. A rapid diagnostic test was positive for P falciparum, and the laboratory reported a parasitemia of <0.2% in blood smear (pregnancy week 25+). The diagnosis was also confirmed by polymerase chain reaction (PCR). The patient was treated with a combination of oral quinine and clindamycin for 10 days after which her anemia

subsided. The fourth patient was a 26-year-old woman who had immigrated to Finland in April 2011 from Kenya, where she had been treated for malaria in January the same year. Three months after immigration, with pregnancy week 22+, she was admitted to the maternity hospital because of high C-reactive protein and abdominal discomfort. A diagnosis of anemia (Hb 101 g/L) was established, a rapid test for malaria http://www.selleckchem.com/products/dinaciclib-sch727965.html proved positive, and a smear revealed a parasitemia of 1.6%. The patient was treated with a combination of oral quinine and clindamycin for 10 days, and remained well after that. In areas where malaria is highly endemic, particularly

in sub-Saharan Africa, constant exposure to the parasite results in a gradual development of immunity starting from early childhood.[1] While severe malaria mostly occurs in children, adults usually get a mild or asymptomatic disease and parasitemia may persist for long periods of time, often unnoticed.[1] In areas where malaria is mainly present during epidemics, such as India, Isotretinoin the exposure to malaria parasites is not frequent enough to elicit similar immunity, and all age-groups are at risk of severe malaria.[2] Pregnant women differ from other patient groups. Even in highly endemic areas, immunity fails to protect women during pregnancy, as P falciparum parasites sequestering in the placenta start to express novel types of antigenic structures not covered by the pre-existing immunity.[3] Moreover, high

numbers of parasites may be present in the placenta even when the peripheral blood malaria smear remains negative or shows only low numbers of parasites.[4, 5] This implies that pregnant women, particularly during their first pregnancy, are at increased risk.[6] During subsequent pregnancies, the immune system will have adapted to the new types of antigens associated with placental sequestration, which will reduce the risk of severe disease.[7] Asymptomatic malaria is quite common among immigrants from highly endemic areas.[8-10] According to various reports, the prevalence of persistent parasitemia among refugees varies from 3% to >60%.[10] While the majority remains asymptomatic,[11] the parasitemia may last for years.[12] There is also a risk of symptomatic malaria in pregnant women; cases have been reported over 3 years after immigration.[12] Persistent parasitemia poses a health risk for both the mother and the unborn child.

with their children was nevertheless included as a control variable in the partial correlations to highlight that the correlations between the measures of main interest were not mediated by this variable. For this particular factor, either Selleckchem Navitoclax the mother’s or father’s response was missing for five children and was substituted by response median. The duration of the playschool attendance (average 17 months;

range 1–30 months) was also included as a control variable. It should be noted that neither the exposure to recorded music nor the duration of the playschool attendance correlated with the response amplitudes or the measures included in the musical activities index with the traditional 0.05 criterion. For all of the control variables, however, the P-value for the correlation with either one or more of the responses or the musical activities index

was lower than 0.20, which justifies the inclusion of these factors in the statistical model (Maldonado & Greenland, 1993) despite the reduction in parsimony. As a further control, two-way independent samples t-tests were conducted to compare the response amplitudes and the composite musical activities scores of the children whose parents (one or both) were active musicians (N = 10) with those of the rest of the children. These preliminary analyses revealed no evidence for differences in response amplitudes between Liothyronine Sodium these LY2109761 solubility dmso groups: musical activities at home score: t23 = 0.06, P = 0.95; duration: MMN t23 = 1.82, P = 0.081, P3a t23 = −1.00,

P = 0.326, LDN t23 = −0.345, P = 0.733; gap: MMN t23 = 1.05, P = 0.306, P3a t23 = −0.793, P = 0.436, LDN t23 = −0.484, P = 0.633; frequency: LDN t23 = −0.504, P = 0.619; intensity: LDN t23 = 1.55, P = 0.136; location: LDN t23 = −0.390, P = 0.700; and novel sounds: P3a t23 = −1.23, P = 0.212, RON t23 = 0.125, P = 0.902. The duration and gap deviants elicited significant MMN-like responses followed by significant P3a-like and LDN-like responses (see Fig. 1A and B, and Table 1). In contrast, the grand-average difference signals of the frequency, intensity, and location deviants were dominated by prominent LDN-like deflections (see Fig. 1C–E and Table 1). The amplitudes of the MMN-like responses to the duration and gap deviants did not correlate with the overall musical activities score. Separate analyses for the child’s musical behaviour score and the singing score did not reveal significant correlations with the MMN amplitudes either. In contrast, the amplitudes of the P3a to the duration and gap deviants, and LDNs to all deviant types were positively correlated with the overall musical activities score, i.e. larger scores were associated with larger P3a and lower LDN amplitudes and vice versa.

41 ± 0.12 °C (n = 30); L. ivanovii, 83.90 ± 0.04 °C (n = 10); L. seeligeri, 84.32 ± 0.08 °C Selleck PS341 (n = 10); L. grayi, 85.03 ± 0.05 °C (n = 10); L. monocytogenes, 85.52 ± 0.13 °C (n = 30); and L. welshimeri, 86.15 ± 0.05 °C (n = 10; Fig. 2b). Thus, the Q-PCR and HRM analysis

specific to Listeria was applied and able to discriminate among the six Listeria species correctly. Listeria welshimeri was chosen to evaluate the sensitivity of the assay via a 10-fold serial dilution. The results showed that when serial dilutions of positive plasmid containing the target gene from L. welshimeri were tested along with a blank control, the LLOD was approximately 5 copies μL−1 (Fig. 3a). Furthermore, the HRM analysis showed that the Tm values were species-specific to L. welshimeri regardless of the plasmid’s

concentration (Fig. 3b), and a linear regression of the data provided the formula: cycle threshold (Ct) = –3.245 × log find more (copies μL−1) + 33.23, to calculate the unknown concentration of gene copies (Fig. 3c). Separately, to determine the sensitivity of this approach in detecting Listera in food products, the juice was inoculated to contain L. monocytogenes at 10–107 CFU mL−1 to evaluate the sensitivity for artificially contaminated samples. The results demonstrated that the sensitivity of artificially contaminated samples was 102 CFU mL−1 (results not shown). Thirty artificially contaminated samples else were prepared by spiking juice, milk, cheese, and meat with Listeria species respectively. The results showed that 28 of these were correctly identified, including eight L. monocytogenes, five L. welshimeri, five L. innocua, five L. ivanovii, three L. seeligeri

and two L. grayi, and the correction rate was 93.3%. Two juice samples spiked with L. monocytogenes and L. seeligeri tested negative according to Q-PCR and HRM analysis. The earlier results were shown in Table 3. There have been several cases of L. ivanovii, L. seeligeri, L. welshimeri, and L. innocua infections in humans causing febrile diarrhea and bacteremia, indicating the pathogenic potential of these Listeria species in humans (Rocourt & Seeliger, 1985; Andre & Genicot, 1987; Perrin et al., 2003; Gasanov et al., 2005; Guillet et al., 2010). Recently, a case of L. ivanovii infection in a man with a kidney transplant was reported (Guillet et al., 2010). Therefore, the identification of Listeria species is of great importance for antibiotic therapy in clinic. We explored the use of a Q-PCR assay integrated with a postamplification HRM analysis for the identification of members of the Listeria genus. All the Listeria species displayed positive PCR amplification and HRM curves; other closely related organisms did not. Therefore, not only is this assay specific to Listeria species, but the Listeria species were also individually identified through characteristic HRM profiles simultaneously.

2b. Therefore, they may be responsible for Dasatinib in vitro the hydrolysis of RNA by a mechanism similar to RNase A. However, due to localization of aspartic acid (D535) on the surface of catalytic domain as shown in Fig. 2b, its role in RNA hydrolysis by mechanism similar to barnase and colicin E3 cannot be ruled out. Therefore, to determine individual role of conserved amino acid residues in the putative active site of catalytic domain of

xenocin, site-directed mutagenesis was performed. All the conserved amino acid residues were mutated to alanine, and endogenous toxicity assay was performed with each mutant strain. Growth profile of JSR4 strain–containing vector alone was considered as 100% and compared with growth profile of D535A, H538A, E542A, H551A, K564A and R570A strains. From the predicted structure of catalytic domain of xenocin as shown in Fig. 2b, it was observed that H538 was the most surface-exposed histidine residue among the four other present in the catalytic domain. Endogenous assay showed that mutation at H538 position results in the reduction of toxicity by more than 90% after 8 h postinduction as shown in Fig. 2c, which confirmed the role D535 as an important residue of the putative active site. As second conserved histidine residues H551 was nearer to H538 and exposed on the surface, it

may behave as the second histidine residue required for the hydrolysis of RNA by a mechanism similar to RNase A ribonuclease. Therefore, buy Crizotinib H551 was mutated to alanine, and endogenous assay was performed. Results showed that there was only 50% reduction in endogenous toxicity in H551A strain after 8 h of induction as shown in Fig. 2c. One reason for such minimum reduction in endogenous toxicity in H551A strain is that it could be due to partial exposure of H551 to the surface as compared to H538 as revealed by the surface view model of catalytic domain as PTK6 shown in

Fig. 2b. This result indicates that RNA hydrolysis mechanism of catalytic domain of xenocin is different from RNase A ribonuclease. D535 and E542 are two acidic amino acid residues that are conserved, exposed to surface as well as close to the H538 as shown in Fig. 2a and b. These two residues may be responsible for the hydrolysis of RNA by mechanism similar to barnase and colicin E3. Therefore, these two residues were mutated to alanine and analysed by endogenous assay. Endogenous toxicity assay result showed that toxicity was reduced by 70% after 8 h postinduction in E542A strain as shown in Fig. 2c. Structural studies showed that E542 was also a part of cleft formed by D535 and H538, which is exposed to the surface as shown in Fig. 2b. However, studies with D535 strain showed significant reduction (88%) in the endogenous toxicity after 8 h postinduction as shown in Fig. 2c; moreover, D535 was the closest amino acid residue with respect to H538 as shown in Fig. 2a.

These results provide further evidence for increased bihemispheric contributions to motor

control in patients with MS relative to healthy controls. They further suggest that multicentre fMRI studies of FC changes are possible, and provide a potential imaging biomarker for use in experimental therapeutic studies directed at enhancing adaptive plasticity in the disease. “
“Metabolic signals related to feeding and body temperature regulation have profound effects on vigilance. Brown adipose tissue (BAT) is a key effector organ in the regulation of metabolism in several species, including rats and Obeticholic Acid mice. Significant amounts of active BAT are also present throughout adulthood in humans. The metabolic activity of BAT is due to the tissue-specific presence of the uncoupling protein-1 (UCP-1). To test the involvement of BAT thermogenesis in sleep regulation, we investigated the effects of two sleep-promoting stimuli in UCP-1-deficient mice. Sleep

deprivation by gentle handling increased UCP-1 mRNA expression in BAT and elicited rebound increases in non-rapid-eye-movement sleep and rapid-eye-movement sleep accompanied by elevated slow-wave activity of the electroencephalogram. EPZ015666 in vitro The rebound sleep increases were significantly attenuated, by ~ 35–45%, in UCP-1-knockout (KO) mice. Wild-type (WT) mice with capsaicin-induced sensory denervation of the interscapular BAT pads showed similar impairments in restorative sleep responses after sleep deprivation, suggesting a role of neuronal sleep-promoting Afatinib datasheet signaling from the BAT. Exposure of WT mice to 35 °C ambient temperature for 5 days led to increased sleep and body temperature and suppressed feeding and energy expenditure. Sleep increases in the warm environment were significantly suppressed, by ~ 50%, in UCP-1-KO animals while their food intake and energy expenditure did not differ from those of the WTs. These results

suggest that the metabolic activity of the BAT plays a role in generating a metabolic environment that is permissive for optimal sleep. Impaired BAT function may be a common underlying cause of sleep insufficiency and metabolic disorders. “
“Key questions remain regarding the processes governing gliogenesis following central nervous system injury that are critical to understanding both beneficial brain repair mechanisms and any long-term detrimental effects, including increased risk of seizures. We have used cortical injury produced by intracranial electrodes (ICEs) to study the time-course and localization of gliosis and gliogenesis in surgically resected human brain tissue. Seventeen cases with ICE injuries of 4–301 days age were selected.

Technical assistance from Jonathan Chen, Dolly Foti, Hawra Karim, Marcela

Sirolimus Arenas, Edie Bucar, Isba Silva, Michael Boateng-Antwi, Miriam Gonzales, Virginia Tan, Alfonso Brito and Marlyn Rios was greatly appreciated. J.T. was supported by a BioSecurity Scholarship from a Department of Homeland Security grant (2009-ST-062-000018 to H.H.X.). H.C. was supported by a Bridge to the Future program funded by NIH grant 5R25GM049001. All authors have no conflict of interest to declare. “
“Ralstonia eutropha H16 is a Gram-negative lithoautotrophic bacterium and is one of the best biopolymer-producing bacteria. It can grow to high cell densities either under lithoautotrophic or under heterotrophic conditions, which makes it suitable for a number of biotechnological applications. Also, R. eutropha H16 can degrade various aromatic compounds for environmental applications. The mobile group II intron can be used for the rapid and specific disruption of various bacterial genes by insertion into any desired target genes. Here, we applied the mobile group II intron to R. eutropha H16 and

developed a markerless gene knockout system for R. eutropha: RalsTron. As a demonstration www.selleckchem.com/products/Vincristine-Sulfate.html of the system, the phaC1 gene encoding polyhydroxyalkanoate synthase was successfully knocked out in R. eutropha H16. Furthermore, this knockout system would be useful for knocking out genes in other bacteria as well because it is based on a broad-host-range vector and the mobile group II intron that minimally depends on the bacterial hosts. Ralstonia eutropha H16 is a Gram-negative lithoautotrophic bacterium that uses both organic compounds and hydrogen as sources of energy (Pohlmann et al., 2006). It is also one of the best-known biopolymer-producing bacteria that accumulates

polyhydroxyalkanoates, such as poly[R–(–)–3-hydroxybutyrate] (PHB), as intracellular storage granules under growth-limiting conditions in the presence of excess carbon source (Lee, 1996; Pohlmann et al., 2006). High cell density cultivation [∼200 grams dry cell weight per liter (g DCW L−1)] of R. eutropha H16 is possible under either lithoautotrophic or heterotrophic conditions (Repaske & Mayer, 1976; Lee, 1996; Shang et al., 2003). It can also degrade various aromatic compounds (Johnson & Stanier, 1971). These characteristics fantofarone of R. eutropha H16 allow it to be used for a wide range of biotechnological and industrial applications, such as the production of biomolecules (Ewering et al., 2006; Lee, 2006; Pohlmann et al., 2006). In addition, the complete sequencing and annotation of the R. eutropha H16 genome allows the systematic analysis of its physiology and subsequent metabolic engineering (Pohlmann et al., 2006). The site-specific integration of mobile group II introns has been used for the targeted disruption of genes in various bacteria (Karberg et al., 2001; Heap et al., 2007; Yao & Lambowitz, 2007).

Table 4 also demonstrates the effect of the use of HAART on seminal parameters, with a significant drop being found in total sperm count (172.2 vs. 147.5 million; P=0.05), progressive motility (48.8 vs. 44.4%; P=0.01), post-preparation concentration (15.1 vs. 12.7 million; P=0.006) and post-preparation TMCI (7.1 vs. 6.1 million; P=0.002)

and a significant increase in the percentage of abnormal sperm (76.7 vs. 74.5%; P=0.01) in samples from men on HAART. This effect of HAART on semen parameters was supported by the negative correlation demonstrated in Table 3 between duration Gefitinib cost of use and concentration (r=−0.16, P=0.02), total count (r=−0.12, P=0.09) and post-preparation progressive motility (r=−0.19, P=0.01). Paradoxically, there was a positive correlation (r=0.17, P=0.02) between duration of use and pre-preparation progressive motility. Similarly, there was a negative correlation between duration of HIV disease and concentration (r=−0.14, P=0.01) and post-preparation progressive motility (r=−0.15, P=0.02) and a paradoxical positive correlation with

Cabozantinib in vivo pre-preparation progressive motility (r=0.12, P=0.05). A decade as the UK tertiary referral centre for the infertility care of HIV-positive men allows us to present data demonstrating a negative effect of falling CD4 cell count and the use of HAART on semen parameters; this is the only study to demonstrate such effects on post-wash sperm available for treatment. The first study to present data on sperm characteristics in HIV-positive men found no difference in any parameter between their small (n=24) cohort and a control group of HIV-negative men providing semen for general fertility investigation [11]. However, more recently, four larger studies have demonstrated selleck a consistent significant impairment in semen parameters compared with control groups. In one study of 250 men [15], significantly lower ejaculate volume, sperm concentration and sperm motility were

demonstrated compared with a small control group of ‘fertile’ HIV-negative men. In a clinically homogeneous group of 189 HIV-positive men free of AIDS symptoms and who were therefore well enough to be considered for fertility treatment, a significant decrease in ejaculate volume and total sperm count and a detrimental shift in motility from type ‘a’ to type ‘b’ was demonstrated compared with healthy partners of women undergoing IVF for tubal subfertility [14]. Compared with a similar control group, and thus avoiding any bias from the use of sperm from men of proven fertility, we previously reported significant declines in ejaculate volume, sperm concentration, total sperm count, progressive sperm motility and sperm morphology in 104 HIV-positive men [18]. Most recently, semen volume, total sperm count, sperm motility and sperm morphology were found to be impaired in 190 HIV-positive men compared with fertile controls [26].

Polyclonal antiserum against the M. oxyfera and NirS enzyme was raised by injecting rabbits with two synthetic peptides: peptide 1 (amino acid position 139–153: PPDKRPTKPEHNRDW) and peptide

2 (amino acid position 520–534: EKARIDDPRIITPTG). Prior to the immunization, an extra amino-terminal cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec, Belgium). For the M. oxyfera pMMO enzyme, two polyclonal antisera selleck products targeting α-subunit (pMmoB) were raised. α-pMmoB1 was raised by injection of rabbits with two synthetic peptides: peptide 1 (amino acid position 257–271: QTGRMDTPELKPTTE) and peptide 2 (amino acid position 324–337: DPALFPDSRLKIKVE). Prior to the immunization, an extra amino-terminal BGJ398 chemical structure cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec). α-pMmoB2 was generated from a heterologously expressed and purified fragment of pmoB in Escherichia coli as described previously (Harhangi et al., 2002), with the following modifications. Two primers were designed on the pmoB sequence; a forward primer on nucleotide position 790 (CCCGAACTGAAGCCCACGACAGAG) and a reverse primer on nucleotide position 1188 (GCCGCCGACCTCAACAATTTGTCTG). A stop codon

(TAA) was included in the reverse primer so as to express only an N-terminal His-tag. For directional cloning, restriction sites EcoRI and NotI were included in the forward primer and XhoI in the reverse primer. An additional nucleotide (T) was added between EcoRI and NotI so as to bring the sequence in frame. pET-30a(+) (Novagen, Germany) was used as the expression vector. Rosetta cells (Novagen) were used as the expression host. The heterologously expressed protein fragment (amino acid position 264–396) was purified using the HIS-Select® HF nickel affinity gel column (Sigma, The Netherlands) under denaturing conditions using the protocol Exoribonuclease provided by the manufacturer. The identity of the expressed protein fragment was verified by MALDI-TOF MS peptide mass fingerprinting of a tryptic digest of the purified

protein fragment (Harhangi et al., 2002). For each antiserum, two rabbits were immunized using a 3-month immunization protocol. The antisera from both rabbits were pooled and affinity-purified (Eurogentec). The affinity-purified antisera (α-NirS, α-pMmoB1 and α-pMmoB2) were used as the primary antisera in immunoblot analysis and immunogold localization as described later. Approximately 2 g of cells (wet weight) was taken from the M. oxyfera enrichment culture. The cells were washed three times with 20 mM phosphate buffer pH 8.0 and resuspended in a medium containing 20 mM sodium phosphate and 50 mM sodium pyrophosphate pH 8.0. Cells were broken by sonication. Cell debris was removed by centrifugation (6000 g, 15 min, 4 °C), and the supernatant was collected as whole-cell extract.

5 However, following exposure, the median time to seroconversion is about 46 days, whereas clinical signs appear after about

30 days and ranges can be broad (1–12 wk).6,7 Therefore, there is an approximate 2-week seronegative window, requiring further serological testing to confirm seroconversion. The low sensitivity and delayed positivity of serological tests during the early phase of AS are due to the types of antigens (worm and egg) used for the tests. This www.selleckchem.com/products/PD-0332991.html lack of sensitivity and delayed positivity could be improved by new diagnostic tools. Cell-free parasite DNA detection of schistosoma in plasma is a promising solution for AS. The specificity is about 100% for Schistosoma mansoni, although the intrinsic quality of the test remains elusive given that the ideal primers are yet to be defined.8 Furthermore, this new tool needs more testing with Schistosoma haematobium and Schistosoma japonicum infection. Nonetheless this test should be used when facing a typical clinical situation find more after exposure in an endemic area. This test is not currently available. Culprit species are identified by analyzing eggs in human excreta (stools and urine), but this test lacks sensitivity. When testing is performed soon after infection the results are negative. The median detection time varies from 5 to 10

weeks after exposure. Early treatment with praziquantel (PZQ) delays oviposition by several weeks.7,9 It is worth noting that different phases of the parasitic lifecycle may overlap in a patient who is infected with many schistosomulae. Migrating schistosomulae may spend some ADP ribosylation factor time in the blood circulation before finding their way to the hepatic portal system and then to the peri-intestinal or peri-vesical blood vessels where they settle.4,10 This is not a synchronous process, and schistosomulae of different

stages of maturity coexist at a given time. In AS, schistosome egg excretion by mature schistosomes may thus coincide for several weeks with circulating schistosomulae.8,10 This has important treatment implications.9,11 PZQ, which is the major treatment of chronic schistosomiasis is ineffective on young (7- to 28-d-old) schistosomulae.12 Unsurprisingly, it does not prevent the chronic phase of the disease.7,13 Moreover, the use of PZQ during AS may be associated with paradoxical reaction (or Jarish Herxheimer-like reaction) in 40% of 10 French patients and 56% of 9 Belgian patients, respectively.7,9 Therefore, we should wait at least 3 months after exposure before initiating PZQ treatment when the chronic stage has been reached. In addition it will be necessary to repeat the administration of PZQ to ensure effective treatment to take into account the schistosomulae that may not yet have reached the adult stage. Corticosteroids may be prescribed in association with PZQ to avoid or attenuate this paradoxical reaction. Nonetheless there are some data arguing against this association.

, 2007; Crespi et al., 2011). Three mechanisms may contribute to non-retinotopic processing. One involves an explicit spatiotopic map implemented by neurons whose receptive fields are head-centered or object-centered (referred to as the spatiotopic map). Such neurons have been found in the parietal cortex (Galletti et al., 1993; Duhamel et al., 1997; Chafee et al., 2007; Crowe et al., 2008), and are arguably implicated in other visual areas (d’Avossa et al.,

2007; McKyton & Zohary, 2007; Crespi et al., 2011). Another mechanism of non-retinotopic processing involves updating of stimulus representation on a retinotopic map associated with saccadic eye movements (referred to as peri-saccadic updating). Such updating phenomena have been observed in the parietal (Duhamel et al., 1992; Merriam et al., 2003), frontal (Sommer & Wurtz, 2006) and visual (Nakamura Oligomycin A mw & Colby, 2002; Merriam et al., 2007) cortical areas. The third possible mechanism entails predictive remapping of spatial attention in retinotopic coordinates to keep track of spatiotopic locations of attended objects around saccades (referred

to as attentional BKM120 molecular weight remapping) (Cavanagh et al., 2010; Rolfs et al., 2011). Our recent study has shown that perceptual learning in motion direction discrimination between two stimuli is specific to the relative positions of the two stimuli in a spatiotopic reference frame (Zhang & Li, 2010), suggesting that spatiotopic processing mechanisms in the

dorsal visual pathway can be altered in favor of the trained spatial relation of the stimuli. However, Interleukin-3 receptor it is unclear whether perceptual learning of stimulus attributes processed by the ventral pathway has similar spatiotopic specificity; it remains unknown which of the non-retinotopic mechanisms described above could account for the spatiotopic learning effect. Investigation of these issues can provide insights into spatiotopic processing and perceptual learning. A total of 51 naive subjects with normal or corrected-to-normal eyesight were recruited from undergraduate and graduate students. Each of the subjects was required to sign an informed consent form before the experiments. The current study conformed with the Declaration of Helsinki, and was approved by the ethics committee of Beijing Normal University. The stimuli were generated with a matlab-based psychophysics toolbox (Brainard, 1997; Pelli, 1997) on a computer monitor (Iiyama Vision Master Pro 514, 100-Hz frame rate at 1600 × 1200 pixels) at a viewing distance of 60 cm. A head-and-chin rest was used to stabilize the subject’s head, and a desktop-mounted tracking system (EyeLink 1000; SR Research Ltd., Mississauga, Ontario, Canada) was used to monitor the subject’s eye positions in each trial, ensuring the faithfulness of their gaze direction.